View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_102 (Length: 228)
Name: NF2071_high_102
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_high_102 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 7951006 - 7950805
Alignment:
Q |
15 |
atcaacaaaaatagagccgacgatatatgagaaaatatccattagcaagttgcatccattgcctaattgattaagttgcacttaagcgattagatcctag |
114 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7951006 |
atcaacaaaaatagagcagacgatatatgagaaaatatccattagcgagttgcatccattgcctaattgattaagttgcacttaagcgattagatcctag |
7950907 |
T |
|
Q |
115 |
gtgtaatcgattagctnnnnnnncaat-aacaaaaatagatcatattatatagaagaaacttttatcaatatcatatattaaggcattctagaagaataa |
213 |
Q |
|
|
|||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7950906 |
gtgtaatcgattagctaaaaaaaaaatcaacaaaaatagagcatattatatagaagaaacttttatcaatatcatatattaaggcattctagaagaataa |
7950807 |
T |
|
Q |
214 |
tc |
215 |
Q |
|
|
|| |
|
|
T |
7950806 |
tc |
7950805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7835 times since January 2019
Visitors: 7737