View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2071_high_105 (Length: 219)

Name: NF2071_high_105
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2071_high_105
NF2071_high_105
[»] chr5 (3 HSPs)
chr5 (18-103)||(28093126-28093211)
chr5 (168-203)||(28093276-28093311)
chr5 (168-203)||(28093368-28093403)


Alignment Details
Target: chr5 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 18 - 103
Target Start/End: Original strand, 28093126 - 28093211
Alignment:
18 tactgcataataccattttctggctataccatttctttataatctgtcaatcaaattatgcactgttgtgtgtgatttactgacat 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28093126 tactgcataataccattttctggctataccatttctttataatctgtcaatcaaattatgcactgttgtgtgtgatttactgacat 28093211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 203
Target Start/End: Original strand, 28093276 - 28093311
Alignment:
168 tgcgggaatctgtgttttgtgtgcgaccttatccgt 203  Q
    ||||||||||||||||||||||||||||||||||||    
28093276 tgcgggaatctgtgttttgtgtgcgaccttatccgt 28093311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 168 - 203
Target Start/End: Original strand, 28093368 - 28093403
Alignment:
168 tgcgggaatctgtgttttgtgtgcgaccttatccgt 203  Q
    ||||||||||||||||||||||||||||||||||||    
28093368 tgcgggaatctgtgttttgtgtgcgaccttatccgt 28093403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 9031 times since January 2019
Visitors: 7893