View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_106 (Length: 218)
Name: NF2071_high_106
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_high_106 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 70 - 202
Target Start/End: Complemental strand, 5293362 - 5293231
Alignment:
Q |
70 |
aaaactacatagcccacattccaatgtctcaagataacagcactagttaggtgttaataatgatgtttccnnnnnnnnnnnnnnnataatttgtggttgt |
169 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
5293362 |
aaaactacatagcccacattccaatgtctcaagataacagcactagttaggtgttaataatgatgtttcc-tttttttactttttataatttgtggttgt |
5293264 |
T |
|
Q |
170 |
gctcaaatccaaaatatttgtgtgtgaccatat |
202 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
5293263 |
gctcaaatccaaaatatttgtgtgtgaccatat |
5293231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11005 times since January 2019
Visitors: 8059