View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_52 (Length: 357)
Name: NF2071_high_52
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_high_52 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 6e-56; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 214 - 336
Target Start/End: Original strand, 413018 - 413140
Alignment:
Q |
214 |
aaatagatatgcctccaagttaattaggcagtgatttagcttaggagtactaaattgtataacataaatcgatgacggaagtacggagcatgaattgctg |
313 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
413018 |
aaatagatatgcctccaagttaattaggcagtgatttagcttaagaggactaaattgtataacataaatcgatgacggaagtacggagcatgaattgttg |
413117 |
T |
|
Q |
314 |
tctataattgcgacaaaagctgt |
336 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
413118 |
tctataattgcgacaaaagctgt |
413140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 6 - 92
Target Start/End: Original strand, 412035 - 412121
Alignment:
Q |
6 |
ttttttgtcatggacttaaagttctatttcgttgaccaaattgagtcttctagtcggtgttaaggactaaaatgagttttcacttta |
92 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
412035 |
ttttttgtcatggacttaaagttatatttcgttgaccaaattgagtcttctagtcgttgttaaggactaaaatgagttttcacttta |
412121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 159 - 187
Target Start/End: Original strand, 412473 - 412501
Alignment:
Q |
159 |
gcttgctcgtaagatatcataattagata |
187 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
412473 |
gcttgctcgtaagatatcataattagata |
412501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14173 times since January 2019
Visitors: 8375