View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_60 (Length: 328)
Name: NF2071_high_60
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_high_60 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 16 - 317
Target Start/End: Complemental strand, 44837205 - 44836904
Alignment:
Q |
16 |
caaggtatagaatggtggaaactaggtttagtgaggcatgtgtttaccaagctgaattggtgagtaaagagtttgatgatgggaaattttgcgatgtgga |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44837205 |
caaggtatagaatggtggaaactaggtttagtgaggcatgtgtttaccaagctgaattggtgagtaaagagtttgatgatgggaaattttgcgatgtgga |
44837106 |
T |
|
Q |
116 |
aaagaatgggaagtgtttgatattgggatggaaggggactccaatgtattcaatctcagcttggaggtttctttgatggtgatcttcaattttgatttct |
215 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44837105 |
aaagaatgggaagtgtttgatattgggatggaaggggactccaatgtattcaatctcagcttggaggtttctttgatggtgatcttcaattttgatttct |
44837006 |
T |
|
Q |
216 |
ttgtgaaatataatgccaagtttaaatttcttctaattcctcatttgttggcttgtttgaatctatttttgttttgtttgaaacagtttatatttgctct |
315 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44837005 |
ttgtgaaatataatgccaagtttaaatttcttctaattcctcatttgttggcttgtttgaatctatttttgttttgtttgaaacagtttatatttgctct |
44836906 |
T |
|
Q |
316 |
gt |
317 |
Q |
|
|
|| |
|
|
T |
44836905 |
gt |
44836904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 38926684 - 38926509
Alignment:
Q |
16 |
caaggtatagaatggtggaaactaggtttagtgaggcatgtgtttaccaagctgaattggtgagtaaagagtttgatgatgggaaattttgcgatgtgga |
115 |
Q |
|
|
||||||||||||||||||||||| | || |||||| | | |||| |||||| | ||||| | |||| ||||||| |||||| ||||| | | || |
|
|
T |
38926684 |
caaggtatagaatggtggaaactggattcagtgagtcttcaatttatcaagctaatttggttactaaaaagtttgactgtgggaagttttgtactataga |
38926585 |
T |
|
Q |
116 |
aaagaatgggaagtgtttgatattgggatggaaggggactccaatgtattcaatctcagcttggaggtttctttga |
191 |
Q |
|
|
|| |||||||||||||| ||| | |||||||| ||||||||||| |||||||||||||||||| |||||||||| |
|
|
T |
38926584 |
caaaaatgggaagtgtttaataattggatggaaagggactccaattcattcaatctcagcttggaagtttctttga |
38926509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14745 times since January 2019
Visitors: 8422