View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_61 (Length: 327)
Name: NF2071_high_61
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071_high_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 145 - 311
Target Start/End: Complemental strand, 24983421 - 24983255
Alignment:
| Q |
145 |
aggtgtggtcactcaactcatatattcagttctttatgtggagtgtggacattagaattaaggcaaacatttcattagagatgcaaatattgattattgg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24983421 |
aggtgtggtcactcaactcatatattcagttctttatgtggagtgtggacattagaattaaggcaaacatttcattagagatgcaaatattgattattgg |
24983322 |
T |
|
| Q |
245 |
tcatcaatatgaatccctcaaccttgctaagaacgttctgcaataccttgatgactgtgtttcttac |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24983321 |
tcatcaatatgaatccctcaaccttgctaagaacgttctgcaataccttgatgactgtgtttcttac |
24983255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 13 - 112
Target Start/End: Complemental strand, 24983517 - 24983423
Alignment:
| Q |
13 |
gagaatgaacaggtaagtaaatgtgaacattgagaaaatattattatatgtgattgagctttgtgagttgtgattgcttgagaaaaagtaatcaatacag |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24983517 |
gagaatgcacaggtaagtaaatgtgaacattgagaaaatattat-----gtgattgaactttgtgagttgtgattgcttgagaaaaagtaatcaatacag |
24983423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16293 times since January 2019
Visitors: 3768