View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_71 (Length: 268)
Name: NF2071_high_71
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071_high_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 154
Target Start/End: Complemental strand, 26613838 - 26613703
Alignment:
| Q |
19 |
ctaggacgtccaagagaagcaatgttacaattagctcttcttccatcaattactgggtttggatcagcacaagcccttctagctgattctggatcacgaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26613838 |
ctaggacgtccaagagaagcaatgttacaattagctcttcttccatcaattactgggtttggatcagcacaagcccttctagctgattctggatcacgaa |
26613739 |
T |
|
| Q |
119 |
atgttacctgcacattcaatatttatcatatcatat |
154 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26613738 |
atgttacctgcacaatcaatatttatcatatcatat |
26613703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 220 - 255
Target Start/End: Complemental strand, 26613638 - 26613603
Alignment:
| Q |
220 |
catacaaatccgtatcctttagattttcctgtgttc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
26613638 |
catacaaatccgtatcctttagattttcctgtgttc |
26613603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 74
Target Start/End: Complemental strand, 9036981 - 9036935
Alignment:
| Q |
28 |
ccaagagaagcaatgttacaattagctcttcttccatcaattactgg |
74 |
Q |
| |
|
|||||||||||||| || ||||| ||||||||||||||||| ||||| |
|
|
| T |
9036981 |
ccaagagaagcaatattgcaatttgctcttcttccatcaataactgg |
9036935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11521 times since January 2019
Visitors: 8091