View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2071_high_72 (Length: 267)

Name: NF2071_high_72
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2071_high_72
NF2071_high_72
[»] chr4 (1 HSPs)
chr4 (13-250)||(53208012-53208249)


Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 53208249 - 53208012
Alignment:
13 aaaattatttaaacaataaggaatgcaatgatatatttatattcgtgtcacaattgataacaagaaggaccacccaaaaactatgagtgaaacaaggtca 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53208249 aaaattatttaaacaataaggaatgcaatgatatatttatattcgtgtcacaattgataacaagaaggaccacccaaaaactatgagtgaaacaaggtca 53208150  T
113 aggaccaccaagattataatagttgttggtgaacgatgataactaatagaaaattctttgttgaaaagccaacccaataatagagataattaattagtac 212  Q
    |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53208149 aggaccaccaagattataatagttgttggtgaacgatgaccactaatagaaaattctttgttgaaaagccaacccaataatagagataattaattagtac 53208050  T
213 aatatcactaatgattcccaattgtacacatagctata 250  Q
    ||||||||||||||||||||||||||| ||||||||||    
53208049 aatatcactaatgattcccaattgtacgcatagctata 53208012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 14783 times since January 2019
Visitors: 8422