View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2071_high_77 (Length: 250)

Name: NF2071_high_77
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2071_high_77
NF2071_high_77
[»] chr5 (2 HSPs)
chr5 (27-190)||(35802663-35802826)
chr5 (61-137)||(10521033-10521109)
[»] chr4 (6 HSPs)
chr4 (13-154)||(55705559-55705700)
chr4 (45-154)||(45878670-45878779)
chr4 (34-97)||(54304053-54304116)
chr4 (53-148)||(56208877-56208972)
chr4 (86-154)||(47293221-47293289)
chr4 (45-102)||(45860206-45860263)
[»] chr8 (1 HSPs)
chr8 (27-154)||(7972415-7972542)
[»] chr2 (1 HSPs)
chr2 (53-154)||(24354011-24354112)


Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 27 - 190
Target Start/End: Complemental strand, 35802826 - 35802663
Alignment:
27 tcagttctcttgcttccgaaaaacccgtcattgcttcaatgtctgatgtggcaacaaatgcaggatactacatggcaatcggagccggaactatcgtagc 126  Q
    |||| |||||||||||  |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| ||||| ||| ||||||||||    
35802826 tcagatctcttgcttcaaaaaaacccgtcattgcttcaatgtctgatgcggcaacaagtgcaggatactacatggcaatgggagcaggagctatcgtagc 35802727  T
127 agaaaatcttactttaactggttcaattcgaggaacactctctcaatactttaaccttgacaat 190  Q
    ||||||||||||||||||||||||||||||||||||  | |||||| |||||||||||||||||    
35802726 agaaaatcttactttaactggttcaattcgaggaacggtttctcaaaactttaaccttgacaat 35802663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 61 - 137
Target Start/End: Original strand, 10521033 - 10521109
Alignment:
61 ttcaatgtctgatgtggcaacaaatgcaggatactacatggcaatcggagccggaactatcgtagcagaaaatctta 137  Q
    ||||||||||||||| ||| ||| ||||||||||||||||||||  ||||| |||  ||||||||||||||||||||    
10521033 ttcaatgtctgatgtagcagcaagtgcaggatactacatggcaacgggagcaggagatatcgtagcagaaaatctta 10521109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 13 - 154
Target Start/End: Original strand, 55705559 - 55705700
Alignment:
13 aatatgggcagcagtcagttctcttgcttccgaaaaacccgtcattgcttcaatgtctgatgtggcaacaaatgcaggatactacatggcaatcggagcc 112  Q
    |||||||| || | |||| ||||||||| || ||||||| |||||||||||||||| ||| |||||| | | ||||||||| ||||||||||| |||||     
55705559 aatatgggaagaaatcaggtctcttgctgcccaaaaacctgtcattgcttcaatgtatgacgtggcagccagtgcaggatagtacatggcaatgggagct 55705658  T
113 ggaactatcgtagcagaaaatcttactttaactggttcaatt 154  Q
    ||||  || ||||||||||||||||| |||||||||||||||    
55705659 ggaataatagtagcagaaaatcttacattaactggttcaatt 55705700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 45 - 154
Target Start/End: Complemental strand, 45878779 - 45878670
Alignment:
45 aaaaacccgtcattgcttcaatgtctgatgtggcaacaaatgcaggatactacatggcaatcggagccggaactatcgtagcagaaaatcttactttaac 144  Q
    ||||||| ||||||||||||||||||||||||||| ||| || |||||||||||||||||| ||||| ||| |||| || ||||||| ||| || |||||    
45878779 aaaaaccagtcattgcttcaatgtctgatgtggcagcaagtggaggatactacatggcaatgggagcaggagctattgttgcagaaagtctaaccttaac 45878680  T
145 tggttcaatt 154  Q
    ||||||||||    
45878679 tggttcaatt 45878670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 34 - 97
Target Start/End: Original strand, 54304053 - 54304116
Alignment:
34 tcttgcttccgaaaaacccgtcattgcttcaatgtctgatgtggcaacaaatgcaggatactac 97  Q
    ||||||| ||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||    
54304053 tcttgctgccgaaaaacccatcattgcttcaatatctgatgtggcaacaagtgcaggatactac 54304116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 53 - 148
Target Start/End: Complemental strand, 56208972 - 56208877
Alignment:
53 gtcattgcttcaatgtctgatgtggcaacaaatgcaggatactacatggcaatcggagccggaactatcgtagcagaaaatcttactttaactggt 148  Q
    ||||||||||| |||||| || || || ||| || ||||||| |||||||||| ||||| |||  ||| || |||||||||||||| |||||||||    
56208972 gtcattgcttcgatgtctcatatgacagcaagtggaggataccacatggcaatgggagcaggagttattgttgcagaaaatcttaccttaactggt 56208877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 86 - 154
Target Start/End: Original strand, 47293221 - 47293289
Alignment:
86 gcaggatactacatggcaatcggagccggaactatcgtagcagaaaatcttactttaactggttcaatt 154  Q
    |||||||||||| ||||||| || || |||  ||| || |||||||||||||| |||||||||||||||    
47293221 gcaggatactacgtggcaatgggcgcaggagttattgttgcagaaaatcttaccttaactggttcaatt 47293289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 45 - 102
Target Start/End: Complemental strand, 45860263 - 45860206
Alignment:
45 aaaaacccgtcattgcttcaatgtctgatgtggcaacaaatgcaggatactacatggc 102  Q
    |||||||  |||||||||||||||||||||||||| | | || ||||||||| |||||    
45860263 aaaaaccaatcattgcttcaatgtctgatgtggcagctagtggaggatactatatggc 45860206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 27 - 154
Target Start/End: Complemental strand, 7972542 - 7972415
Alignment:
27 tcagttctcttgcttccgaaaaacccgtcattgcttcaatgtctgatgtggcaacaaatgcaggatactacatggcaatcggagccggaactatcgtagc 126  Q
    |||| |||||||||||| ||||||| || |||||||  ||||||||| ||||||  |  |||||||||||||||||||| || || |||  ||| || ||    
7972542 tcaggtctcttgcttccaaaaaaccagttattgctttgatgtctgatctggcaatgagcgcaggatactacatggcaatgggcgcaggagttattgttgc 7972443  T
127 agaaaatcttactttaactggttcaatt 154  Q
    |||||| ||||| |||||||||||||||    
7972442 agaaaaccttaccttaactggttcaatt 7972415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 53 - 154
Target Start/End: Original strand, 24354011 - 24354112
Alignment:
53 gtcattgcttcaatgtctgatgtggcaacaaatgcaggatactacatggcaatcggagccggaactatcgtagcagaaaatcttactttaactggttcaa 152  Q
    ||||||||||| ||| ||||||||||| ||| || |||||||||||||||||| ||| | |   |||| || ||||||| |||||| |||||||||||||    
24354011 gtcattgcttcgatggctgatgtggcagcaagtggaggatactacatggcaatgggaactgatgctattgttgcagaaagtcttaccttaactggttcaa 24354110  T
153 tt 154  Q
    ||    
24354111 tt 24354112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 15762 times since January 2019
Visitors: 3757