View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_81 (Length: 250)
Name: NF2071_high_81
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_high_81 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 36281837 - 36281624
Alignment:
Q |
1 |
cgttatttgcttggagattgtcaattaaagaatcccatcaaaggataatannnnnnngctgtaatgtggtgcctaccggttcattactatgtttgtaatg |
100 |
Q |
|
|
||||||||||||||||||| ||||||| ||||||||||||||| |||||| || ||||||||||||||||| ||| ||||||||||||||||| |
|
|
T |
36281837 |
cgttatttgcttggagattttcaattatagaatcccatcaaagaataatatttttt-gccctaatgtggtgcctaccgcttcgttactatgtttgtaatg |
36281739 |
T |
|
Q |
101 |
gtatttaaagaaggaaacaattaatcaactatttcttggatgtgacttctttggtaatatctgaaattgtatttttcgtcgggttgaaatctctttagtt |
200 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||| |
|
|
T |
36281738 |
gtatttaaagaaggaaacaattaatcatctatttcttggatatgacttctttggtaatatctgaaactgtgtttttcgtcggattgaaatctctttagtt |
36281639 |
T |
|
Q |
201 |
aatacaactgacatt |
215 |
Q |
|
|
||||||||||||||| |
|
|
T |
36281638 |
aatacaactgacatt |
36281624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 112 - 156
Target Start/End: Complemental strand, 44347025 - 44346981
Alignment:
Q |
112 |
aggaaacaattaatcaactatttcttggatgtgacttctttggta |
156 |
Q |
|
|
|||||||||||||||| |||||| |||| |||||||||||||||| |
|
|
T |
44347025 |
aggaaacaattaatcatctatttgttggttgtgacttctttggta |
44346981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7931 times since January 2019
Visitors: 7737