View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_85 (Length: 246)
Name: NF2071_high_85
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_high_85 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 32969706 - 32969883
Alignment:
Q |
1 |
tctactttgtcactttatattcgtccaaaaattatagataaaagttgaattgaatttttctttggtggtgaaagttggattgaattatacagaagttgat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32969706 |
tctactttgtcactttatattcgtccaaaaattatagataaaagttgaattgaatttttctttggtggtgaaagttggattgaattatacagaagttgat |
32969805 |
T |
|
Q |
101 |
ggctgtcgtctcgagatccaagcatgttaaataaagtttatctcataaattttatacacaatttattcatggtgatat |
178 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32969806 |
ggctgtcgtctcgagatccaagcatgttaaataaagtttatctcataaattttatacacaatttattcatggtgatat |
32969883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8584 times since January 2019
Visitors: 7803