View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_90 (Length: 241)
Name: NF2071_high_90
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_high_90 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 38124247 - 38124066
Alignment:
Q |
16 |
cattttcatctaaagaaaaccttcccggaacaatgcctgaactattattagaattaagcttcttcaatgaagaagaagatgcaagttttcctgtgaatct |
115 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
38124247 |
cattttcatctaaagaaaaccttcccggaacaatgcctgaaccattattagaattaagcttcttcaatgaagaagaagatccaagttttcctgtgaatct |
38124148 |
T |
|
Q |
116 |
tccagaaccaccaattgctcttgtttgatcattttcaaacgttctaatctctctttgactcttttgtgaaagagtgaaacta |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
T |
38124147 |
tccagaaccaccaattgctcttgtttgatcattttcaaacgttctaatctctctgtgactcttttgtgaaagagggaaacta |
38124066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14238 times since January 2019
Visitors: 8375