View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_92 (Length: 239)
Name: NF2071_high_92
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071_high_92 |
 | |
|
| [»] scaffold0219 (5 HSPs) |
| | |
|
| [»] scaffold0474 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0219 (Bit Score: 209; Significance: 1e-114; HSPs: 5)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 29082 - 28862
Alignment:
| Q |
1 |
tttcaaaggagcaaatcgaattgcttcgagttgccgttcatgatgtaagttactttcatatacttcttatattttattttaagtgtcttatttgtaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29082 |
tttcaaaggagcaaatcgaattgcttcgagttgccgttcatgatgtaagttactttcatatacttcttatattttattataagtgtcttatttgtaatat |
28983 |
T |
|
| Q |
101 |
taatttatctcaacctaattactactaatatcttatgttttaaacattgacctcaattttgcaggactcagattctaatgcaagaccattgcaaccatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28982 |
taatttatctcaacctaattactactaatatcttatgttttaaacattgacctcaactttgcaggactcagattctaatgcaagatcattgcaaccatta |
28883 |
T |
|
| Q |
201 |
aacaaccgtttagtgcaactc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28882 |
aacaaccgtttagtgcaactc |
28862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 126 - 221
Target Start/End: Complemental strand, 23743 - 23648
Alignment:
| Q |
126 |
taatatcttatgttttaaacattgacctcaattttgcaggactcagattctaatgcaagaccattgcaaccattaaacaaccgtttagtgcaactc |
221 |
Q |
| |
|
|||||| |||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23743 |
taatatattatgttttaaacattgagctaaactttgcaggactcagattctaatgcaagaccattgcaaccattaaacaaccgtttagtgcaactc |
23648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 23935 - 23863
Alignment:
| Q |
1 |
tttcaaaggagcaaatcgaattgcttcgagttgccgttcatgatgtaagttactttcatatacttcttatatt |
73 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||| |
|
|
| T |
23935 |
tttcaaaggagcagattgaattgcttcaagttgccgttcataatgtaagttactttcatacacttcctatatt |
23863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 9 - 62
Target Start/End: Complemental strand, 12091 - 12038
Alignment:
| Q |
9 |
gagcaaatcgaattgcttcgagttgccgttcatgatgtaagttactttcatata |
62 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||||||||||||||||||||||| |
|
|
| T |
12091 |
gagcaaatcgaattgcttcaagctgctgttcatgatgtaagttactttcatata |
12038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 217
Target Start/End: Complemental strand, 11796 - 11737
Alignment:
| Q |
158 |
tttgcaggactcagattctaatgcaagaccattgcaaccattaaacaaccgtttagtgca |
217 |
Q |
| |
|
||||||||||| || | |||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
11796 |
tttgcaggactatgactataatgcaagaccattgcagccattaaacaaccgcttagtgca |
11737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 6799 - 6843
Alignment:
| Q |
1 |
tttcaaaggagcaaatcgaattgcttcgagttgccgttcatgatg |
45 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6799 |
tttcgaaggagcaaatcgaattgcttcgagttgccgttcatgatg |
6843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 45
Target Start/End: Complemental strand, 20101295 - 20101256
Alignment:
| Q |
6 |
aaggagcaaatcgaattgcttcgagttgccgttcatgatg |
45 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
20101295 |
aaggagaaaattgaattgcttcgagttgccgttcatgatg |
20101256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15812 times since January 2019
Visitors: 3757