View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_high_94 (Length: 237)
Name: NF2071_high_94
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_high_94 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 2655886 - 2656094
Alignment:
Q |
18 |
attactgaagaaggtgtctcaacctcaacagaaccttcatcatctgaaccactacacaatgcataaaaaatgctacccgaataagagttgtcactagtcc |
117 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2655886 |
attactgaagaaggtgtctcaacctcaacagaatcttcatcatctgaaccactacacaatgcataaaaaatgctacccgaataagagttgtcactagtcc |
2655985 |
T |
|
Q |
118 |
tacttgaaatttctatctttttcctttcctgaattgtggccattttcttctgatttggactcagataaatggaacctcttctagtttctatattctcttc |
217 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2655986 |
tacttgaaatttctatctttttcctttcctgaattgtggccattttcttctgatttggactcagataaatggaacctcttctagtttctatattctcttc |
2656085 |
T |
|
Q |
218 |
tagcctatg |
226 |
Q |
|
|
||| ||||| |
|
|
T |
2656086 |
tagtctatg |
2656094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15771 times since January 2019
Visitors: 3757