View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_103 (Length: 236)
Name: NF2071_low_103
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_low_103 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 7383744 - 7383521
Alignment:
Q |
3 |
gaatattataaggttttgtttgaaaatggcaatgttttagcttacgccttacagtgaatgatcttataaacttatgtgattaaaatagatttgtttgtc- |
101 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
7383744 |
gaatattataaggttttgtttgaaaatggcaatgtttgagcttacgccttacagtgaatgatcttataaactcatgtgattaaaatagatttgtttgtca |
7383645 |
T |
|
Q |
102 |
---nnnnnnnnnnttctgccaagagtttataaca-ttttttactgacttatatatannnnnnnnnataattgacttctaatagggtttgaaaatttatag |
197 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
7383644 |
aaaaaaaaaaaaattctgccaagagtttataacatttttttactgacttatatatttttttttttataattgacttctaatagggtttgaaaatttatag |
7383545 |
T |
|
Q |
198 |
cttacgaattacgatttcttttct |
221 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
7383544 |
cttacgaattacgatttcttttct |
7383521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8528 times since January 2019
Visitors: 7803