View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_110 (Length: 218)
Name: NF2071_low_110
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_low_110 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 34 - 202
Target Start/End: Original strand, 40282652 - 40282822
Alignment:
Q |
34 |
tcgaagaatatttaattaatttgaagatatgaagatgaattcaacttagatttccaatgagcatatacctaaacatatgttcagttaagaagttactagt |
133 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40282652 |
tcgaacaatatttaattaatttgaagatatgaagatgaattcaacttagatttccaatgagcatatacctaaacatatgttcagttaagaagttactagt |
40282751 |
T |
|
Q |
134 |
ttatcaactaatcaaatgacaagtagtaacaaatcattag--tatataatcatcatctccctgcaataaag |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
40282752 |
ttatcaactaatcaaatgacaagtagtaacaaatcattagtatatataatcatcatctccctgcaataaag |
40282822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9634 times since January 2019
Visitors: 7932