View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_112 (Length: 215)
Name: NF2071_low_112
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_low_112 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 47807101 - 47807283
Alignment:
Q |
17 |
aatatcaagcttatctacctaaagcgaagcttggtattcgagttatctaaacagcctgaaagctttgtgagtagagtggttggaacttttgttagagcca |
116 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
T |
47807101 |
aatatcaagcttatctacctaaagcgaagcttggtattcgagttatcgaaacagcctgaaagctttgcgagtagggtgattggaacttttgttagagcca |
47807200 |
T |
|
Q |
117 |
gagtagattccaatgatcataagctaaggaattcataccatcttgtgagagtcataggtataataaattgcatatagatcttg |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47807201 |
gagtagattccaatgatcataagctaaggaattcataccatcttgtgagagtcataggtataataaattgcatatagatcttg |
47807283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 17 - 199
Target Start/End: Original strand, 47804539 - 47804721
Alignment:
Q |
17 |
aatatcaagcttatctacctaaagcgaagcttggtattcgagttatctaaacagcctgaaagctttgtgagtagagtggttggaacttttgttagagcca |
116 |
Q |
|
|
||||||||||||||||||||||| | ||||||||| |||||||||| ||||| ||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
T |
47804539 |
aatatcaagcttatctacctaaaacaaagcttggtgatcgagttatcgaaacaacctgaaagctttgcgagtagggtggttggaacttttgttagagcca |
47804638 |
T |
|
Q |
117 |
gagtagattccaatgatcataagctaaggaattcataccatcttgtgagagtcataggtataataaattgcatatagatcttg |
199 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47804639 |
gagtagattccaatgatcataagctaaggaattcataccatcttgtgagagtcataggtataataaattgcatatagatcttg |
47804721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13115 times since January 2019
Visitors: 8270