View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_113 (Length: 213)
Name: NF2071_low_113
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071_low_113 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 29664364 - 29664172
Alignment:
| Q |
1 |
tccttctcgattgttataaatcaaagaaggatgtatcaactataa-ttttttcatggtgtgatatctaataaataaataaatttaatcgtcaacattgat |
99 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||| |||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29664364 |
tccttctccattgttataaatcaaagaaggatatatcaactataaattttttcatg---tgatatctaataaatgaattaatttaatcgtcaacattgat |
29664268 |
T |
|
| Q |
100 |
tttaactgtctttaatcattttaaatctatcaataatcagaccagtgttgagacatattttggtgatgaggtgaagaagggagtgtaggagtgtgaca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29664267 |
gttaactgtctttaatcattttaaatctatcaataatcagaccagtgttgagac--attttggtgatgaggtgaagaagggagtgtaggagtgtgaca |
29664172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9630 times since January 2019
Visitors: 7932