View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_117 (Length: 204)
Name: NF2071_low_117
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_low_117 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 29 - 188
Target Start/End: Complemental strand, 34640421 - 34640262
Alignment:
Q |
29 |
acccatattactgaaatgttcctttgtagaccaaaaaactgatttcattttagataatttactcnnnnnnnnttgtattgttccaaaatgatattaattg |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
34640421 |
acccatattactgaaatgttcctttgtagaccaaaaaactgatttcattttagataatttactttaaaaaaattgtattgttccaaaatgatattaattg |
34640322 |
T |
|
Q |
129 |
cttctttattttacttgtattatacttgtatcacataccaaaattggatcattttagatg |
188 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
34640321 |
cttctttattttacttgtattatacttgtattacataccaaaattggatcattttagatg |
34640262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11210 times since January 2019
Visitors: 8059