View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_22 (Length: 481)
Name: NF2071_low_22
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 430; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 430; E-Value: 0
Query Start/End: Original strand, 1 - 477
Target Start/End: Original strand, 24983703 - 24984177
Alignment:
| Q |
1 |
tatttacgtatgttggaacaaaatgcgtatgccagtgtgtgaattgaattttttgtatacgtcccacacaggagagactagatacaatactaatatttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24983703 |
tatttacgtatgttggaacaaaatgcgtatgccagtgtgtgaattgaattttttgtatacgtcccacacaggagagactagatacaatactaatatttat |
24983802 |
T |
|
| Q |
101 |
ataatgcatgtatgataccttgggctgtgctcgaaggggtgcccaattttaaaaccgggagatgacacagtcaagatgatcaaatcacatgcgcgcccgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
24983803 |
ataatgcatgtatgataccttgggctgtgctcgaaggggtgcccaattttaaaaccgggagatgacacagtcaacatgatcaaatcacatgagcgcccgg |
24983902 |
T |
|
| Q |
201 |
caccatctagtctgctgggcttggactacatggcaaattaagatcctgtccatgccatctcaacgtcacacttctaaatatgtttgcgtgtgtccaacac |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24983903 |
caccatctagtcagctgggcttggacta--tggcgaattaagatcctgtccatgccatctcaacgtcacgcttctaaatatgtttgcgtgtgtccaacac |
24984000 |
T |
|
| Q |
301 |
attccacatctgctttaattttcggtatgttcgggtcgttcgtttcccaacagatatgcaatataagtcatcattattgtttcatttttagttttcgcac |
400 |
Q |
| |
|
||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24984001 |
attccgcatccgctttaattttcggtattttcgggtcgttcgtttcccaacagatatgcaatataagtcatcattattgtttcatttttagttttcgcac |
24984100 |
T |
|
| Q |
401 |
tatataaagggtgctcggatctcattttaactcacaccaaaactcaaagcattatagagttttctctcttctccctt |
477 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24984101 |
tatataaagggtgctcggatctcatcttaactcacaccaaaactcaaagcattatagagttttctctcttctccctt |
24984177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 431 - 476
Target Start/End: Complemental strand, 10572698 - 10572653
Alignment:
| Q |
431 |
ctcacaccaaaactcaaagcattatagagttttctctcttctccct |
476 |
Q |
| |
|
||||||||||||||| ||| ||| | |||||||||||||||||||| |
|
|
| T |
10572698 |
ctcacaccaaaactcgaagaatttttgagttttctctcttctccct |
10572653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8649 times since January 2019
Visitors: 7803