View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_30 (Length: 444)
Name: NF2071_low_30
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_low_30 |
| |
|
Alignment Details
Target: chr5 (Bit Score: 406; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 406; E-Value: 0
Query Start/End: Original strand, 1 - 435
Target Start/End: Original strand, 14414089 - 14414523
Alignment:
Q |
1 |
tcgtcaccatattcttaaaaaacaagttgtcaagcaacgctggtgtctcatcgaaattcactacagggtttctaaaaagaggtgtcccagggttcgcaca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14414089 |
tcgtcaccatattcttaaaaaacaagttgtcaagcaacgctggtgtctcatcgaaattcactacagggtttctaaaaagaggtgtcccagggttcgcaca |
14414188 |
T |
|
Q |
101 |
tatttgttgaagctcattaacaattggaaatggaagcaaaggatcaggtttcctcgtgtctgcgtaattgtaaatcctttccataaaaacatcgcaatga |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14414189 |
tatttgttgaagctcattaacaattggaaatggaagcaaaggatcaggtttcctcgtgtctgcgtaattgtaaatcctttccataaaaacatcgcaatga |
14414288 |
T |
|
Q |
201 |
gccacaccaattgaatgcgcaccaagtaaaataaccatttcttcaattgtgaaaccnnnnnnngtaaagaggtcaaccattttttccatcggccaattag |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
T |
14414289 |
gccacaccaattgaatgcgcaccaagtaaaataaccatttcttcaattgtgaaacctttttttgtgaagaggtcaaccattttttccatcggccaattag |
14414388 |
T |
|
Q |
301 |
gcattggaaggttgtcgtcttccgcaatagatgctagggaatagagcgcatctctacggcctccaaggggagctgtacgaggtaatccggaaaggaacat |
400 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14414389 |
gcattggaaggttgtcgtcttccgcgatagatgctagggaatagagcgcatctctacggcctccaaggggagctgtacgaggtaatccggaaaggaacat |
14414488 |
T |
|
Q |
401 |
tccttcgttaactgaaaatgctattgtgtctgtgc |
435 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
14414489 |
tccttcgttaactgaaaatgctattgtgtctgtgc |
14414523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11620 times since January 2019
Visitors: 8091