View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_51 (Length: 368)
Name: NF2071_low_51
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071_low_51 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 313
Target Start/End: Original strand, 425837 - 426145
Alignment:
| Q |
17 |
agttaaatggtggtactcatacgtacgtttatgtggaaactagttgtataaggaaccttccgtgggctgaatcacacgtttatcttccaataatgtttga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
425837 |
agttaaatggtggtactcatacgtacgtttatgtggaaactatttttataaggaaccttccgtgggctgaatcacacgtttatcttccaataatgtttga |
425936 |
T |
|
| Q |
117 |
tctctttgtgatgnnnnnnnnnnnngtcttaatcctctcatttgtagggaagggcaatatcaagtttaatagaaaggtaaataagtttgtctaacaattg |
216 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
425937 |
tctctttgtgatgttttttctttttgtcttaatcctctcatttgtagggaagggcaatatcaagtttaatagaaaggtaaataagtttgtctaacaattg |
426036 |
T |
|
| Q |
217 |
tttcaattaagattcaaaatttctcaaataatttgtctttaatccaaat------------gagaaatgatatttatacaaccatttgggatcgacaacc |
304 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
426037 |
tttcaattaagattcaaattttctcaaataatttgtctttaatccaaattcattcataaaagagaaatgatatttatacaaccatttgggatcgacaacc |
426136 |
T |
|
| Q |
305 |
ttttgacaa |
313 |
Q |
| |
|
||||||||| |
|
|
| T |
426137 |
ttttgacaa |
426145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 262 - 291
Target Start/End: Original strand, 15678169 - 15678198
Alignment:
| Q |
262 |
aaatgagaaatgatatttatacaaccattt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15678169 |
aaatgagaaatgatatttatacaaccattt |
15678198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7865 times since January 2019
Visitors: 7737