View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_60 (Length: 337)
Name: NF2071_low_60
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071_low_60 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 319
Target Start/End: Original strand, 42613892 - 42614210
Alignment:
| Q |
1 |
atttatgtgaaaagttgcaaaaactaggctgcacttagtctagtttgttttgataaagttcaagaatttgggttctatcatttgtaccgatcttttgtct |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42613892 |
atttatgttaaaagttgcaaaaactaggctgcacttagtctagtttgttttgataaagttcaagaatttgggttctatcatttgtaccgatcttttgtct |
42613991 |
T |
|
| Q |
101 |
tctggtgaatgaattactttgttgcaagagaaaaataccaaatcaatcattcactcaactcaaagaataagagaatagacatatagttgagtatactcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42613992 |
tctggtgaatgaattactttgttgcaagagaaaaataccaaatcaatcattcactcaactcaaagaataagagaatagacatatagttgagtatactcac |
42614091 |
T |
|
| Q |
201 |
tctctctttagcaaaatataagaaaaaactatatatatagtccaaatttaaatcaaatgcaagtatgttttttacttatatttttgtaaatgataaaact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42614092 |
tctctctttagcaaaatataagaaaaaactatatatatagtccaaatttaaatcaaatgcaagtatgttttttacttatatttttgtaaatgataaaact |
42614191 |
T |
|
| Q |
301 |
tgcaagaagaatatatgat |
319 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42614192 |
tgcaagaagaatatatgat |
42614210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12202 times since January 2019
Visitors: 8179