View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_83 (Length: 250)
Name: NF2071_low_83
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_low_83 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 39281204 - 39281448
Alignment:
Q |
1 |
catgtttgacgatgtggtgaacggagattaaacatttaagggctactgctgagttatgagtggtttggagacggtccatgagaagctccaccgcagagga |
100 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39281204 |
catgtttgacaatgtggtgaacggagattaaacatttaagggctactgctgagttatgagtggtttggagacggtccatgagaagctccaccgcagagga |
39281303 |
T |
|
Q |
101 |
tgcggtggcacgtgaaccgtctccagaggaaagaagagtcaagaggtgtttgtgttttggagggttgtaagaatcgtgtgtagtggcgcgaaggagggaa |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
39281304 |
tgcggtggcacgtgaaccgtctccagaggaaagaagagtcaagaggtgtttgtgttttggagggttgtaagaatcgtgtgtcgtggcgcgaaggagggaa |
39281403 |
T |
|
Q |
201 |
agagttttgctttttgataaaattgcagctttgctctgtgatgct |
245 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
T |
39281404 |
agagttttggtttttgataaaattgcagctttgctttgtgatgct |
39281448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13239 times since January 2019
Visitors: 8270