View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_91 (Length: 244)
Name: NF2071_low_91
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071_low_91 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 38321759 - 38321955
Alignment:
| Q |
1 |
ctaaaagatctttttgtaaagaaagagtttccttacttccaagagtgggaaaatattaaattgtgtactttgttcttgcatcttgttttatcgcttattc |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||| |||||||||| ||||||||||||| ||||||| |
|
|
| T |
38321759 |
ctaaaagatctttttgtaaagaaaaagtttccttacttccaagggtgggagaatattaaattgtgtaatttgttcttgtatcttgttttatcacttattc |
38321858 |
T |
|
| Q |
101 |
taatgatggcagttctactaatcttcactgctgggaaataaagaaaggatatctattgtttttgttgttatatcaagatattactttgagaatattaa |
198 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||||||||||||||||||| | ||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
38321859 |
taatgatggcagttctaataattttcactactgggaaataaagaaaggatatctgtagtttttgttgttatatcaa-attatactttgagaatattaa |
38321955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 18577110 - 18577187
Alignment:
| Q |
1 |
ctaaaagatctttttgtaaagaaagagtttccttacttccaagagtgggaaaatattaaattgtgtactttgttcttg |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18577110 |
ctaaaagatctttttgtaaagaaagagtttccttacttccaagagtgggaaaatattaaattgtgtactttgttcttg |
18577187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 16164 times since January 2019
Visitors: 3768