View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_95 (Length: 241)
Name: NF2071_low_95
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2071_low_95 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 14167471 - 14167248
Alignment:
Q |
1 |
accgttggattcttgaacctgcggagcgtgatgctgttttggcaaatgttgctatcaagagtggcaaaaattacaatgtcattgtggaaatttctgctgt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14167471 |
accgttggattcttgaacctgcggagcgtgatgctgttttggcaaatgttgctatcaagagtggcaaaaattacaatgtcattgtggaaatttctgctgt |
14167372 |
T |
|
Q |
101 |
tctctcccccgaagagctcttgaatgtgagacgtgcttacgtcaaacgctacaagcactccttggaagaagatttggctgcccatacttccggccatctt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14167371 |
tctctcccccgaagagctcttgaatgtgagacgtgcttacgtcaaacgctacaagcactccttggaagaagatttggctgcccatacttccggccatctt |
14167272 |
T |
|
Q |
201 |
cgccaggcaagtcctttttccatt |
224 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
14167271 |
cgccaggcaagtcctttttccatt |
14167248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 14174395 - 14174180
Alignment:
Q |
1 |
accgttggattcttgaacctgcggagcgtgatgctgttttggcaaatgttgctatcaagagtgg---caaaaattacaatgtcattgtggaaatttctgc |
97 |
Q |
|
|
|||||||||| || ||||||||||| || |||||||||||||| ||||| || |||||| ||| ||||| |||| |||| ||| | |||||| | | |
|
|
T |
14174395 |
accgttggatgctggaacctgcggatcgcgatgctgttttggccaatgtagccatcaaggatggaagcaaaagttaccatgtgattattgaaattgtttc |
14174296 |
T |
|
Q |
98 |
tgttctctcccccgaagagctcttgaatgtgagacgtgcttacgtcaaacgctacaagcactccttggaagaagatttggctgcccatacttccggccat |
197 |
Q |
|
|
|||||| || || ||||| | ||| ||||||||||||| || || |||||||| || || ||||||||||| ||||| ||||| |||| ||| |
|
|
T |
14174295 |
tgttctttcacctgaagaagtgttggcaatgagacgtgcttatcataaccgttacaagcattctttagaagaagatttagctgctcataccaccggtcat |
14174196 |
T |
|
Q |
198 |
cttcgccaggcaagtc |
213 |
Q |
|
|
|||||||||||||||| |
|
|
T |
14174195 |
cttcgccaggcaagtc |
14174180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15895 times since January 2019
Visitors: 3757