View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2071_low_99 (Length: 237)
Name: NF2071_low_99
Description: NF2071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2071_low_99 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 3 - 220
Target Start/End: Original strand, 7164395 - 7164617
Alignment:
| Q |
3 |
aatcccaagtctttgatcttctttgatgaaaatctcacaagctccaattcatctggaatattcttgaacctaaaaatccaatttgaacaattagacttaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7164395 |
aatcccaagtctttgatcttctttgatgaaaatctcacaagctccaattcatctggaatattattgaacctaaaaatccaatttgaacaattagac-taa |
7164493 |
T |
|
| Q |
103 |
catatagtttcaact----ttaatacttgaaatagcacggagt--acttactttgtggggatattgtactctggatattttgtattaattaattttgcaa |
196 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7164494 |
catatagtttcaactttaattaatacttgaaatagcacggagtacacttactttgtggggatattgtactctggatattttgtattaattaattttgcaa |
7164593 |
T |
|
| Q |
197 |
tgtcatgaatattagcttcacatg |
220 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
7164594 |
tgtcatgaatattagcttcacatg |
7164617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13085 times since January 2019
Visitors: 8270