View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2100_low_10 (Length: 237)
Name: NF2100_low_10
Description: NF2100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2100_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 18 - 182
Target Start/End: Original strand, 37532404 - 37532572
Alignment:
| Q |
18 |
atactcataatacggacttttatactatctattgtaagtgtacatttaataattttgtctcgatctcnnnnnnnatcac---tatcacatcnnnnnnnnt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| | |
|
|
| T |
37532404 |
atactcataatacggacttttatactatctattgtaagtgtacatttaataattttgtctcgatctctttttttatcacatgtatcacatcaattttttt |
37532503 |
T |
|
| Q |
115 |
t-atcttttatctctcaagatttatacatgttgtttatcaaaccttttatttaaaaagtgatatgcaaa |
182 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37532504 |
ttatcttttatctctcaagatttatacatgttgtttatcaaaccttttatttaaaaagtgatatgcaaa |
37532572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 176 - 237
Target Start/End: Original strand, 37533364 - 37533425
Alignment:
| Q |
176 |
atgcaaatattttcgaaactatactgcaatcttttaattgctacacaaaactttcaagatat |
237 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37533364 |
atgcaaatattttcgaaactatactgtaatcttttaattgctacacaaaactttcaagatat |
37533425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9035 times since January 2019
Visitors: 7893