View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2226-Insertion-7 (Length: 129)
Name: NF2226-Insertion-7
Description: NF2226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2226-Insertion-7 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 4e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 7 - 129
Target Start/End: Complemental strand, 13471167 - 13471044
Alignment:
| Q |
7 |
agttcctacaatcctaactctttcatttaacctctcttaacttgatactttctctgccccatgctcctatgctacactctactctactgcttacatttgt |
106 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| | |
|
|
| T |
13471167 |
agttcctccaatcctaactctctcatttaacctctcttaacttgatactttctctgccccatgctcctattctatactctactctactgcttacattttt |
13471068 |
T |
|
| Q |
107 |
cacacaaa-tatatggtgtagtta |
129 |
Q |
| |
|
|||||||| ||||||| ||||||| |
|
|
| T |
13471067 |
cacacaaattatatggagtagtta |
13471044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8615 times since January 2019
Visitors: 7803