View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2226_high_6 (Length: 261)
Name: NF2226_high_6
Description: NF2226
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2226_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 122 - 252
Target Start/End: Complemental strand, 19246814 - 19246682
Alignment:
| Q |
122 |
gtgcatagaatggatacattaactatatta--gttttttaatatatataaaattgataagaaaaacttataataagagacgaaaatactattatatagca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19246814 |
gtgcatagaatggatacattaactatattatagttttttaatatatataatactgataagaaaaacttataataagagacgaaaagactattatatagca |
19246715 |
T |
|
| Q |
220 |
ccaaatacgtcgttctgttactccaagtataat |
252 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
19246714 |
ccaaatacgtcgttgtgttactccaagtataat |
19246682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11997 times since January 2019
Visitors: 8179