View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332-Insertion-5 (Length: 50)
Name: NF2332-Insertion-5
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2332-Insertion-5 |
| |
|
[»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 43; Significance: 2e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 2e-16
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 14797746 - 14797704
Alignment:
Q |
8 |
aagttggacttgggtgattatgcttcctgggttgtcattcgaa |
50 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14797746 |
aagttggacttgggtgattatgcttcctgggttgtcattcgaa |
14797704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 2e-16
Query Start/End: Original strand, 8 - 50
Target Start/End: Complemental strand, 14806620 - 14806578
Alignment:
Q |
8 |
aagttggacttgggtgattatgcttcctgggttgtcattcgaa |
50 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14806620 |
aagttggacttgggtgattatgcttcctgggttgtcattcgaa |
14806578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10942 times since January 2019
Visitors: 8059