View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_high_17 (Length: 347)
Name: NF2332_high_17
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2332_high_17 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 106 - 347
Target Start/End: Complemental strand, 32778671 - 32778437
Alignment:
Q |
106 |
ggaccaaaattgtaggtcgagcataacaagcgaccaaaaaattatccaacaatttatagcgctccagcctccaagtattttaatgagaacatatctaaga |
205 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
32778671 |
ggaccaaaattgtaggtcgagcataacaagcggccaaaaaattatccaacaatttatagcgctcca-------agtattttaatgagaacatatctaaga |
32778579 |
T |
|
Q |
206 |
atggatagaattagaattgttaatcaaagaattagagttagattatcttacatgtggtattccccctttattgatcgtttttcacctgataatgtgatag |
305 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
32778578 |
atggatagaattagaattgttaatcaaagaattagagttagattatcttacatgtggtattccccctttattgagagtttttcacctgataatgtgatag |
32778479 |
T |
|
Q |
306 |
aataatcagatatgatcgctattttttgtttgttgatggttt |
347 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
32778478 |
aataatcagatatgatcactattttttgtttgttgatggttt |
32778437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11069 times since January 2019
Visitors: 8059