View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_high_19 (Length: 316)
Name: NF2332_high_19
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2332_high_19 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 16 - 298
Target Start/End: Original strand, 47899804 - 47900085
Alignment:
Q |
16 |
aaataattgttgctgtttaaaaaagcaataaagaatgattattatagaaattatcaacaaatgaatagtgagcaaagtgaaagaatcataattaatcatg |
115 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
47899804 |
aaataattgttgctgtttaacaaagcaataaagaatgattattatagaaattatcaacaaatgaatagtgagcaaagtgaaataatcataattaatcatg |
47899903 |
T |
|
Q |
116 |
aaagtataaagcattacaaagaggaatataccttgcatagtaggcagcgacggcagccaagtagacagagtgaatccatttaggggaagtgctatgaaac |
215 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47899904 |
aaagtataaagcattacaa-gaggaatataccttgcatagtaggcagcgacggcagccaagtagacagagtgaatccatttaggggaagtgctatgaaac |
47900002 |
T |
|
Q |
216 |
gcaaccttccataactgaacatgcttaaccatgaatttatattgaccttccatatcattcaatggccaccctgtatactcctt |
298 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47900003 |
gcaaccttccataactgaacatgcttaaccatgaatttatattgaccttccatatcattcaatggccaccctgtatactcctt |
47900085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13932 times since January 2019
Visitors: 8375