View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_high_21 (Length: 291)
Name: NF2332_high_21
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2332_high_21 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 9 - 275
Target Start/End: Original strand, 53056622 - 53056888
Alignment:
Q |
9 |
gacatcatcaggatacctggtgtttgaagatgtcctcatgcatctgcattgtctttttgatggattctatgttgtttctgtcaagcatcctcctatccat |
108 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53056622 |
gacatcttcaggatacctggtgtttgaagatgtcctcatgcatctgcattgtctttttgatggattctatgttgtttctgtcaagcatcctcctatccat |
53056721 |
T |
|
Q |
109 |
gatgggacctggcaatttattgattctagtcctatgatggttattggtcagcctccctttgttctgataataatgctcccacagctaacttattgctctt |
208 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53056722 |
gatgggaccttgcaatttattgattctagtcctatgatggttattggtcagcctccctttgttctgataataatgctcccacagctaacttattgctctt |
53056821 |
T |
|
Q |
209 |
taccaaggttgctacaagatttatggaacattcaattttggttcccatacctaaatacaataattaa |
275 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53056822 |
taccaaggttgctacaagatttatggaacattcaattttggttcccatacctaaatacaataattaa |
53056888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 93
Target Start/End: Complemental strand, 15909439 - 15909366
Alignment:
Q |
20 |
gatacctggtgtttgaagatgtcctcatgcatctgcattgtctttttgatggattctatgttgtttctgtcaag |
93 |
Q |
|
|
|||||||||| ||||||||||||||| || ||||||||||||||| | |||||||| ||||||||||||||||| |
|
|
T |
15909439 |
gatacctggtttttgaagatgtcctcttgtatctgcattgtctttctaatggattccatgttgtttctgtcaag |
15909366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10250 times since January 2019
Visitors: 7975