View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_high_24 (Length: 268)
Name: NF2332_high_24
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2332_high_24 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 44189379 - 44189646
Alignment:
| Q |
1 |
gaaacagtaaactttatgagagcgaaaacattgtgtgattaaaaatcaaaattcattatatctttagggaggaaattcacaattgtaaaagtgtttttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44189379 |
gaaacagtaaactttatgagagcgaaaacattgtgtgattaaaaatcaaaattcattatatctttagggaggaaattcacaattgtaaaagtgtttttta |
44189478 |
T |
|
| Q |
101 |
aggctacatattacatgcacctttcacttgtctgcgctttcccagcgagtgagggtcaataaacatgttagggagtatcattttcttggcagccggagca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44189479 |
aggctacatattacatgcacctttcacttgtctgcgctttcccaacgagtgagggtcgataaacgtgttagggagtatcattttcttggcagccggagca |
44189578 |
T |
|
| Q |
201 |
ggaaggcttgaacacgtcgtctttgaagcctcaaggattttaaatactaaacagtacttggttttgaa |
268 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44189579 |
ggaaggcttgaacatgtcgtctttgaagcctcaaggattttaaatactaaacagtacttggttttgaa |
44189646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12011 times since January 2019
Visitors: 8179