View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_high_31 (Length: 211)
Name: NF2332_high_31
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2332_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 59 - 195
Target Start/End: Complemental strand, 12566814 - 12566678
Alignment:
| Q |
59 |
ttaaatgaggaaaatttggacattttattactgtgaaatctgggtggcttaatgatgtaagattatagttaattttgtttcaatttgtataacatggtaa |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12566814 |
ttaaatgaggaaaatttggacattttattactgtgaaatctgggaggcataatgatgtaagattatagttaattttgtttcaatttgtataacatggtaa |
12566715 |
T |
|
| Q |
159 |
ttgttttttataccaatttagtttcttaccttatgac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12566714 |
ttgttttttataccaatttagtttcttaccttatgac |
12566678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 15 - 64
Target Start/End: Complemental strand, 12566978 - 12566929
Alignment:
| Q |
15 |
atgaagttgagctcagatttgagttagatcttgaaatatgtttattaaat |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12566978 |
atgaagttgagctcagatttgagttagatcttgaaatatgtttattaaat |
12566929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11497 times since January 2019
Visitors: 8091