View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_low_19 (Length: 369)
Name: NF2332_low_19
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2332_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 12 - 207
Target Start/End: Complemental strand, 54615841 - 54615640
Alignment:
| Q |
12 |
atgaatgtaatcagtcttttgagcatcagaaacttttgaattttcctttgagtttgaagtatcttcagctacacagtttttcttggtattcggattcccg |
111 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
54615841 |
atgaatgtaatcagtcttttgaacatcagaaacttttgaattttcctttgagtttgaagtatcttctgctacacagttcttcttggtattcggattcccg |
54615742 |
T |
|
| Q |
112 |
gtgatcttggattctccgtcctcagaacctactttgatcctcttgtctttattctcaat------ttcaccaacaacaacctaaacaacaagcaaaaaat |
205 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54615741 |
gtgatctttgattctccgtcctcagaacctattttgatcctcttgtctttattctcaatttcaatttcaccaacaacaacctaaacaacaagcaaaaaat |
54615642 |
T |
|
| Q |
206 |
ta |
207 |
Q |
| |
|
|| |
|
|
| T |
54615641 |
ta |
54615640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 273 - 355
Target Start/End: Complemental strand, 54615574 - 54615492
Alignment:
| Q |
273 |
ttgaagatcaatgatattcttatgaattatgacctctctatgcaaaattgtacacaccttgagcttagaattatgatgagatt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54615574 |
ttgaagatcaatgatattcttatgaattatgacctctctatgcaaaattgtacacaccttgagcttagaattatgatgagatt |
54615492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10424 times since January 2019
Visitors: 7978