View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2332_low_23 (Length: 347)

Name: NF2332_low_23
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2332_low_23
NF2332_low_23
[»] chr4 (1 HSPs)
chr4 (106-347)||(32778437-32778671)


Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 106 - 347
Target Start/End: Complemental strand, 32778671 - 32778437
Alignment:
106 ggaccaaaattgtaggtcgagcataacaagcgaccaaaaaattatccaacaatttatagcgctccagcctccaagtattttaatgagaacatatctaaga 205  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||    
32778671 ggaccaaaattgtaggtcgagcataacaagcggccaaaaaattatccaacaatttatagcgctcca-------agtattttaatgagaacatatctaaga 32778579  T
206 atggatagaattagaattgttaatcaaagaattagagttagattatcttacatgtggtattccccctttattgatcgtttttcacctgataatgtgatag 305  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||    
32778578 atggatagaattagaattgttaatcaaagaattagagttagattatcttacatgtggtattccccctttattgagagtttttcacctgataatgtgatag 32778479  T
306 aataatcagatatgatcgctattttttgtttgttgatggttt 347  Q
    ||||||||||||||||| ||||||||||||||||||||||||    
32778478 aataatcagatatgatcactattttttgtttgttgatggttt 32778437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 8002 times since January 2019
Visitors: 7737