View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_low_27 (Length: 299)
Name: NF2332_low_27
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2332_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 17 - 178
Target Start/End: Original strand, 23964653 - 23964795
Alignment:
| Q |
17 |
caacttttgcacaaacctagtttatcgagacttccactcatatcaaaacccgaaaaatataacagccgcaaacccttactgcaaccaaccaccaatcggt |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23964653 |
caacttttgaacaaacctagtttatcgagacttccattcatatcaaaacccgaaaaatataacagccgcaaaccct-------------------tcggt |
23964733 |
T |
|
| Q |
117 |
aaccactggaagccagtcgtgaaccaactgggaggcataggaggtccgaccaaaaatcaact |
178 |
Q |
| |
|
|||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23964734 |
aaccactggaagtcagttgtgaaccaacttggaggcataggaggtccgaccaaaaatcaact |
23964795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 225 - 294
Target Start/End: Original strand, 23964794 - 23964863
Alignment:
| Q |
225 |
ctgagagaagtcgagattagtgaaaggttaacctcatgtttagttttatgagagtcttacctatgctact |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23964794 |
ctgagagaagtcgagattagtgaaaggttaacctcatgtttagttttatgagagtcttacctatgttact |
23964863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13023 times since January 2019
Visitors: 8270