View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2332_low_30 (Length: 293)

Name: NF2332_low_30
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2332_low_30
NF2332_low_30
[»] chr1 (1 HSPs)
chr1 (2-114)||(14203301-14203416)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 2 - 114
Target Start/End: Original strand, 14203301 - 14203416
Alignment:
2 gtgtcatttctgtctctgctactttctaatgatgcttaaaggctaaatccacttgccca---attattattatatcacgatcgttcgaaagtggtgtgat 98  Q
    ||||||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||   ||||||||||||||||||||||||||||||||||||||    
14203301 gtgtcatttctgtctctactactttcttatgatgcttaaaggctaaagccacttgcccaattattattattatatcacgatcgttcgaaagtggtgtgat 14203400  T
99 tttacggttctaataa 114  Q
    ||||||||||||||||    
14203401 tttacggttctaataa 14203416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 10310 times since January 2019
Visitors: 7978