View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_low_30 (Length: 293)
Name: NF2332_low_30
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2332_low_30 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 2 - 114
Target Start/End: Original strand, 14203301 - 14203416
Alignment:
Q |
2 |
gtgtcatttctgtctctgctactttctaatgatgcttaaaggctaaatccacttgccca---attattattatatcacgatcgttcgaaagtggtgtgat |
98 |
Q |
|
|
||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
14203301 |
gtgtcatttctgtctctactactttcttatgatgcttaaaggctaaagccacttgcccaattattattattatatcacgatcgttcgaaagtggtgtgat |
14203400 |
T |
|
Q |
99 |
tttacggttctaataa |
114 |
Q |
|
|
|||||||||||||||| |
|
|
T |
14203401 |
tttacggttctaataa |
14203416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10310 times since January 2019
Visitors: 7978