View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_low_31 (Length: 292)
Name: NF2332_low_31
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2332_low_31 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 292
Target Start/End: Complemental strand, 33221667 - 33221391
Alignment:
| Q |
15 |
agcagagatgcaaaacacaacaaaattaattgatagnnnnnnnntacaagatacttcttcacttcacacacaacacaaccctcgccgaatgaaagtagcg |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33221667 |
agcagagatgcaaaacacaacaaaatcaattgatagaaaaaaa-tacaagatacttcttcacttcacacacaacacaaccctcgccgaatgaaagtagcg |
33221569 |
T |
|
| Q |
115 |
tgaatcatgtgtctcaaataagtggaaaagacattgatgtccttaaaacctcgtacgtgtcagtgtatctttgttttcactctcaacaacttaagtgggg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33221568 |
tgaatcatgtgtctcaaataagtggaaaagacattgatgtccttaaaacctcgtacgtgtcagtgtatctttgttttcactctcaacaacttaagtgggg |
33221469 |
T |
|
| Q |
215 |
ccatataagggtactcaaggtaacattgcagtgtgtctataaaattcacatccctttcattttacgattgtattgtgt |
292 |
Q |
| |
|
||||||||||||| || ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33221468 |
ccatataagggtattcgaggtaacattgtagtgtgtctataaatttcacatccctttcattttacgattgtattgtgt |
33221391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12993 times since January 2019
Visitors: 8270