View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_low_34 (Length: 272)
Name: NF2332_low_34
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2332_low_34 |
| |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 7380594 - 7380338
Alignment:
Q |
1 |
ttaaggatgttgtaatgttaaaataatgttttggtcnnnnnnnggaaagaataatgttttgtggttttggaagagggaaatatataggagggaaaatagg |
100 |
Q |
|
|
||||| ||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7380594 |
ttaagtatgttataatgttaaaataatgttttggtctttttttggaa-gaataatgttttgtggttttggaagagggaaatatataggagggaaaatagg |
7380496 |
T |
|
Q |
101 |
agatgcttggttttgatgaaggagtagaatggatagaaaaagagatgtggatttaatatttaaaggggagattaattaaggtggtttggattaatttgag |
200 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7380495 |
agatggttggttttgatgaaggagtagaatggatagaaaaagagatgtggatttaatatttaaaggggagattaattaaggtggtttggattaatttgag |
7380396 |
T |
|
Q |
201 |
atggaggtatagtctagaggtttctattaattaaagtccaacattaacatgtgactat |
258 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7380395 |
atggaggtatagtctagaggtttctattaattaaagtccaacattaacatgtgactat |
7380338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12236 times since January 2019
Visitors: 8179