View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_low_38 (Length: 244)
Name: NF2332_low_38
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2332_low_38 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 41602334 - 41602129
Alignment:
| Q |
20 |
gtattttacatgtttttagtttttgaaaaagaggattcttgcatatgtggagataaactctatgtataccttgaacggttcatttatttttgaagaaaaa |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41602334 |
gtatttgacatgtttttagtttttgaaaaagaggattcttgcatatgtggagataaactctacgtataccttgaacggttcatttgtttttgaagaaaaa |
41602235 |
T |
|
| Q |
120 |
taagtgaggtgatcagaagggcaagtacaaccatgtggtgacaaaacttcattcaagttctacaacaatgtattcactttgaaaccacttgatcgacttg |
219 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41602234 |
taagtgaggtgatcagaatggcaattacaaccatgtggtgacaaaacttcattcaagttctacaacaatgtattcactttgaaaccacttgatcgacttg |
41602135 |
T |
|
| Q |
220 |
catgcc |
225 |
Q |
| |
|
|||||| |
|
|
| T |
41602134 |
catgcc |
41602129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9289 times since January 2019
Visitors: 7893