View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2332_low_39 (Length: 238)
Name: NF2332_low_39
Description: NF2332
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2332_low_39 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 9684558 - 9684337
Alignment:
Q |
1 |
gtaggcttgtgaactagtccttttgatgttgtgagtgaattttggtcctttcatttgtgttttcattttcaatccttgtcatcaacttgtcttgatgtgt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9684558 |
gtaggcttgtgaactagtccttttgatgttgtgagtgaattttggtcctttcatttgtgttttcattttcaatccttgtcatcaacttgtcttgatgtgt |
9684459 |
T |
|
Q |
101 |
gcatagaaaaagcttacacatgagaaaaatggtctatatgaggaaactttgttgatgatgagtttctgaatattttgtggctacaagttcttaaggtatt |
200 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
9684458 |
gcatagaaaaagctgacacatgagaaaaatggtctatatgaggaaactttgttgatgatgagtttctgaatattttgtggctacaagttctgaaggtatt |
9684359 |
T |
|
Q |
201 |
tgaagttctattgttttcttat |
222 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
9684358 |
tgaagttctattgttttcttat |
9684337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15759 times since January 2019
Visitors: 3757