View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496-1-Insertion-3 (Length: 113)
Name: NF2496-1-Insertion-3
Description: 454-NF2496-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2496-1-Insertion-3 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.00000000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 74 - 113
Target Start/End: Complemental strand, 24354975 - 24354936
Alignment:
| Q |
74 |
tacctctaactttcttatgaggtcgaggagaaacgaaagg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24354975 |
tacctctaactttcttatgaggtcgaggagaaacgaaagg |
24354936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 24355043 - 24355005
Alignment:
| Q |
8 |
ttttacatagaaaattgcatcaatccaatatctatatgt |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24355043 |
ttttacatagaaaattgcatcaatccaatatgtatatgt |
24355005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 219 times since January 2019
Visitors: 6542