View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2496-1-Insertion-5 (Length: 60)
Name: NF2496-1-Insertion-5
Description: 454-NF2496-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2496-1-Insertion-5 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 2e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 33556363 - 33556422
Alignment:
Q |
1 |
gtttccccaatctgttatgaattgttgctcacatgaaacaaaaatatgtccttaaaatct |
60 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33556363 |
gtttccccaatctgttatgaattgttgctcacatgaaacaaaaatatgtccttaaaatct |
33556422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4172 times since January 2019
Visitors: 5895