View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2685_high_7 (Length: 237)
Name: NF2685_high_7
Description: NF2685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2685_high_7 |
| |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 64 - 163
Target Start/End: Complemental strand, 30385301 - 30385202
Alignment:
Q |
64 |
taaagtagatccttctgttatgtatgaactagaaaaatggcatctatggtagaacttttaatagagaggaagaaaaactatattgtcagatatgcatatt |
163 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30385301 |
taaagtagatccttctgttatgtatgaactagaaaaatggcatctatggtagaacttttaatagagaggaagaaaaactatattgtcagatatgcatatt |
30385202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 551 times since January 2019
Visitors: 6879