View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2685_high_9 (Length: 224)

Name: NF2685_high_9
Description: NF2685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2685_high_9
NF2685_high_9
[»] chr1 (2 HSPs)
chr1 (4-161)||(47417251-47417408)
chr1 (190-224)||(47417437-47417471)


Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 4 - 161
Target Start/End: Original strand, 47417251 - 47417408
Alignment:
4 ttaccatttcttgaagtataagctagacatcatactgacactgatggagacattgcaacggtgagaaatgacaacgtttttaggccatgtttcagtgtca 103  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47417251 ttaccatttcttgaagcataagctagacatcatactgacactgatggagacattgcaacggtgagaaatgacaacgtttttaggccatgtttcagtgtca 47417350  T
104 ggtataagtttggttatgaggatagtttgttacttatatttccaccacttgattggaa 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47417351 ggtataagtttggttatgaggatagtttgttacttatatttccaccacttgattggaa 47417408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 190 - 224
Target Start/End: Original strand, 47417437 - 47417471
Alignment:
190 gacacatggaagaagaaactatcttaaacctctaa 224  Q
    |||||||||||||||||||||||||||||||||||    
47417437 gacacatggaagaagaaactatcttaaacctctaa 47417471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 132 times since January 2019
Visitors: 6969