View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2685_high_9 (Length: 224)
Name: NF2685_high_9
Description: NF2685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF2685_high_9 |
| |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 4 - 161
Target Start/End: Original strand, 47417251 - 47417408
Alignment:
Q |
4 |
ttaccatttcttgaagtataagctagacatcatactgacactgatggagacattgcaacggtgagaaatgacaacgtttttaggccatgtttcagtgtca |
103 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47417251 |
ttaccatttcttgaagcataagctagacatcatactgacactgatggagacattgcaacggtgagaaatgacaacgtttttaggccatgtttcagtgtca |
47417350 |
T |
|
Q |
104 |
ggtataagtttggttatgaggatagtttgttacttatatttccaccacttgattggaa |
161 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47417351 |
ggtataagtttggttatgaggatagtttgttacttatatttccaccacttgattggaa |
47417408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 190 - 224
Target Start/End: Original strand, 47417437 - 47417471
Alignment:
Q |
190 |
gacacatggaagaagaaactatcttaaacctctaa |
224 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
47417437 |
gacacatggaagaagaaactatcttaaacctctaa |
47417471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 132 times since January 2019
Visitors: 6969