View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2685_low_8 (Length: 237)

Name: NF2685_low_8
Description: NF2685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2685_low_8
NF2685_low_8
[»] chr8 (1 HSPs)
chr8 (64-163)||(30385202-30385301)


Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 64 - 163
Target Start/End: Complemental strand, 30385301 - 30385202
Alignment:
64 taaagtagatccttctgttatgtatgaactagaaaaatggcatctatggtagaacttttaatagagaggaagaaaaactatattgtcagatatgcatatt 163  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30385301 taaagtagatccttctgttatgtatgaactagaaaaatggcatctatggtagaacttttaatagagaggaagaaaaactatattgtcagatatgcatatt 30385202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 437 times since January 2019
Visitors: 6824