View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2947-Insertion-12 (Length: 72)

Name: NF2947-Insertion-12
Description: NF2947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2947-Insertion-12
NF2947-Insertion-12
[»] chr4 (1 HSPs)
chr4 (12-72)||(26475057-26475118)
[»] chr3 (2 HSPs)
chr3 (18-72)||(7424725-7424779)
chr3 (8-72)||(12220882-12220946)
[»] scaffold0036 (2 HSPs)
scaffold0036 (21-72)||(64086-64138)
scaffold0036 (21-72)||(69228-69280)
[»] scaffold0236 (1 HSPs)
scaffold0236 (15-72)||(10199-10256)
[»] chr1 (1 HSPs)
chr1 (12-72)||(2660637-2660697)
[»] chr7 (1 HSPs)
chr7 (15-70)||(28006817-28006872)


Alignment Details
Target: chr4 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 12 - 72
Target Start/End: Original strand, 26475057 - 26475118
Alignment:
12 agtgggtgtgttggttttttg-gagtggctttgatgtgagtagcaggcgataggtgtttgga 72  Q
    ||||||||||||||||||||  ||||||||||||||||| || |||||||||||||||||||    
26475057 agtgggtgtgttggtttttttagagtggctttgatgtgaatatcaggcgataggtgtttgga 26475118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000002; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 7424779 - 7424725
Alignment:
18 tgtgttggttttttggagtggctttgatgtgagtagcaggcgataggtgtttgga 72  Q
    ||||||| ||||||| | |||||||| |||||||||||| |||||||||||||||    
7424779 tgtgttgcttttttgaattggctttggtgtgagtagcagacgataggtgtttgga 7424725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 72
Target Start/End: Original strand, 12220882 - 12220946
Alignment:
8 tttcagtgggtgtgttggttttttggagtggctttgatgtgagtagcaggcgataggtgtttgga 72  Q
    ||||||| | ||||||  |||| ||||||||||||||| |||||||||| ||||| |||||||||    
12220882 tttcagtagatgtgtttcttttctggagtggctttgatttgagtagcagacgatatgtgtttgga 12220946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 33; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 72
Target Start/End: Complemental strand, 64138 - 64086
Alignment:
21 gttggttttttggagtggctttgatgtgagtagcag-gcgataggtgtttgga 72  Q
    |||| ||||||||||||||||||||||||||||| | |||||||| |||||||    
64138 gttgattttttggagtggctttgatgtgagtagccgcgcgataggcgtttgga 64086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036; HSP #2
Raw Score: 33; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 72
Target Start/End: Complemental strand, 69280 - 69228
Alignment:
21 gttggttttttggagtggctttgatgtgagtagcag-gcgataggtgtttgga 72  Q
    |||| ||||||||||||||||||||||||||||| | |||||||| |||||||    
69280 gttgattttttggagtggctttgatgtgagtagccgcgcgataggcgtttgga 69228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0236 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: scaffold0236
Description:

Target: scaffold0236; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 10256 - 10199
Alignment:
15 gggtgtgttggttttttggagtggctttgatgtgagtagcaggcgataggtgtttgga 72  Q
    ||||||| || |||||||||||||||||| |||||||||  ||||| || ||||||||    
10256 gggtgtgatgattttttggagtggctttggtgtgagtagtgggcgacagatgtttgga 10199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.00000008
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 2660697 - 2660637
Alignment:
12 agtgggtgtgttggttttttggagtggctttgatgtgagtagcaggcgataggtgtttgga 72  Q
    |||||||||  |||||||||||||| |||||| ||||||||| ||| |||  |||||||||    
2660697 agtgggtgtaatggttttttggagtagctttggtgtgagtagtaggtgatgagtgtttgga 2660637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 70
Target Start/End: Original strand, 28006817 - 28006872
Alignment:
15 gggtgtgttggttttttggagtggctttgatgtgagtagcaggcgataggtgtttg 70  Q
    ||||||| || |||| | ||||||||||| |||||||||| || ||||||||||||    
28006817 gggtgtgatgattttcttgagtggctttggtgtgagtagcgggtgataggtgtttg 28006872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 12064 times since January 2019
Visitors: 8179